>NM_018284 Homo sapiens guanylate binding protein 3 (GBP3), mRNA (2952 bp)
CAGTTTCATTAGGCTCTGAAGCCATTACAAAGGTTGCTTAACTTCTAATTATTTGATCAC
TGAGGAAAATCCAGAAAGCTACACAACACTGAAGGGGTGAAATAAAAGTCCAGCGATCCA
GCGAAAGAAAAGAGAAGTGACAGAAACAACTTTACCTGGACTGAAGATAAAAGCACAGAC
AAGAGAACAATGCCCTGGACATGGCTCCAGAGATCCACATGACAGGCCCAATGTGCCTCA
TTGAGAACACTAATGGGGAACTGGTGGCGAATCCAGAAGCTCTGAAAATCCTGTCTGCCA
TTACACAGCCTGTGGTGGTGGTGGCAATTGTGGGCCTCTACCGCACAGGAAAATCCTACC
TGATGAACAAGCTAGCTGGGAAGAATAAGGGCTTCTCTCTGGGCTCCACAGTGAAATCTC
ACACCAAAGGAATCTGGATGTGGTGTGTGCCTCACCCCAAAAAGCCAGAACACACCTTAG
TCCTGCTTGACACTGAGGGCCTGGGAGATGTAAAGAAGGGTGACAACCAGAATGACTCCT
GGATCTTCACCCTGGCCGTCCTCCTGAGCAGCACTCTCGTGTACAATAGCATGGGAACCA
TCAACCAGCAGGCTATGGACCAACTGTACTATGTGACAGAGCTGACACATCGAATCCGAT
CAAAATCCTCACCTGATGAGAATGAGAATGAGGATTCAGCTGACTTTGTGAGCTTCTTCC
CAGATTTTGTGTGGACACTGAGAGATTTCTCCCTGGACTTGGAAGCAGATGGACAACCCC
TCACACCAGATGAGTACCTGGAGTATTCCCTGAAGCTAACGCAAGGTAACAGGAAGCTTG
CCCAGCTTGAGAAACTACAAGATGAAGAGCTGGACCCTGAATTTGTGCAACAAGTAGCAG
ACTTCTGTTCCTACATCTTTAGCAATTCCAAAACTAAAACTCTTTCAGGAGGCATCAAGG
TCAATGGGCCTTGTCTAGAGAGCCTAGTGCTGACCTATATCAATGCTATCAGCAGAGGGG
ATCTGCCCTGCATGGAGAACGCAGTCCTGGCCTTGGCCCAGATAGAGAACTCAGCCGCAG
TGCAAAAGGCTATTGCCCACTATGACCAGCAGATGGGCCAGAAGGTGCAGCTGCCCGCAG
AAACCCTCCAGGAGCTGCTGGACCTGCACAGGGTTAGTGAGAGGGAGGCCACTGAAGTCT
ATATGAAGAACTCTTTCAAGGATGTGGACCATCTGTTTCAAAAGAAATTAGCGGCCCAGC
TAGACAAAAAGCGGGATGACTTTTGTAAACAGAATCAAGAAGCATCATCAGATCGTTGCT
CAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATT
CGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACT
ATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCA
AGGAGTCTGTGACCGATGCAATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGG
AGATTGAAGTGGAATGTGTAAAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGG
AAATGCAAATAAAGTATCAGCAGATGATGGAAGAGAAAGAGAAGAGTTATCAAGAACATG
TGAAACAATTGACTGAGAAGATGGAGAGGGAGAGGGCCCAGTTGCTGGAAGAGCAAGAGA
AGACCCTCACTAGTAAACTTCAGGAACAGGCCCGAGTACTAAAGGAGAGATGCCAAGGTG
AAAGTACCCAACTTCAAAATGAGATACAAAAGCTACAGAAGACCCTGaaaaaaaaaaCCA
AGAGATATATGTCGCATAAGCTAAAGATCTAAACAACAGAGCTTTTCTGTCATCCTAACC
CAAGGCATAACTGAAACAATTTTAGAATTTGGAACAAGTGTCACTATATTTGATAATAAT
TAGATCTTGCATCATAACACTAAAAGTTTACAAGAACATGCAGTTCAATGATCAAAATCA
TGTTTTTTCCTTAAAAAGATTGTAAATTGTGCAACAAAGATGCATTTACCTCTGTACCAA
CAGAGGAGGGATCATGAGTTGCCACCACTCAGAAGTTTATTCTTCCAGACGACCAGTGGA
TACTGAGGAAAGTCTTAGGTAAAAATCTTGGGACATATTTGGGCACTGGTTTGGCCAAGT
GTACAATAGGTCCCAATATCAGAAACAACCATCCTAGCTTCCTAGGGAAGACAGTGTACA
GTTCTCCATTATATCAAGGCTACAAGGTCTATGAGCAATAATGTGATTTCTGGACATTGC
CCATGGATAATTCTCACTGATGGATCTCAAGCTAAAGCAAACCATCTTATACAGAGATCT
AGAATCTTATATTTTCCATAGGAAGGTAAAGAAATCATTAGCAAGAGTAGGAATTGAATC
ATAAACAAATTGGCTAATGAAGAAATCTTTTCTTTCTTGTTCAATTCATCTAGATTATAA
CCTTAATGTGACACCTGAGACCTTTAGACAGTTGACCCTGAATTAAATAGTCACATGGTA
ACAATTATGCACTGTGTAATTTTAGTAATGTATAACATGCAATGATGCACTTTAACTGAA
GATAGAGACTATGTTAGAAAATTGAACTAATTTAATTATTTGATTGTTTTAATCCTAAAG
CATAAGTTAGTCTTTTCCTGATTCTTAAAGGTCATACTTGAAATCCTGCCAATTTTCCCC
AAAGGGAATATGGAAttttttttGACTTTCTTTTGAGCAATAAAATAATTGTCTTGCCAT
TACTTAGTATATGTAGACTTCATCCCAATTGTCAAACATCCTAGGTAAGTGGTTGACATT
TCTTACAGCAATTACAGATTATTTTTGAACTAGAAATAAACTAAACTAGAAACaaaaaaa
aaaaaaaaaaaa