>NM_003193 Homo sapiens tubulin-specific chaperone e (TBCE), mRNA (1882 bp)
GTTGGCTGGAGGGGCTGCTGCTGGGAACACCTGGAGTCTCCGCGGGCAGATCTCATATTT
TGGATTCTGGATATATTATAATGAGTGACACTTTGACAGCGGATGTCATTGGTCGAAGAG
TTGAAGTTAATGGAGAACATGCAACAGTACGTTTTGCTGGTGTTGTCCCTCCCGTGGCAG
GACCCTGGTTAGGAGTAGAATGGGACAATCCCGAGAGAGGAAAGCATGATGGGAGCCACG
AAGGGACTGTGTATTTTAAATGCAGGCACCCGACAGGAGGATCCTTTATTCGTCCGAACA
AGGTAAATTTTGGAACAGACTTTCTTACTGCAATTAAGAACCGCTATGTGTTAGAAGATG
GACCAGAGGAAGATAGAAAAGAGCAAATTGTTACAATTGGAAATAAACCTGTGGAGACTA
TCGGTTTTGACTCTATTATGAAACAGCAAAGTCAGCTGAGCAAGTTGCAAGAAGTTTCTC
TGAGGAACTGTGCAGTAAGTTGTGCTGGTGAAAAAGGAGGAGTTGCTGAAGCATGTCCTA
ATATCAGAAAGGTAGATTTGTCAAAAAACCTGTTGTCATCATGGGATGAAGTGATACACA
TTGCTGATCAGCTCAGACACCTGGAAGTCCTTAATGTCAGTGAAAATAAACTAAAATTTC
CCTCCGGTTCAGTATTAACTGGAACGCTTTCTGTACTGAAGGTTTTAGTCCTCAATCAAA
CAGGAATAACGTGGGCTGAGGTGCTGCGGTGTGTCGCGGGGTGCCCAGGCCTGGAGGAAC
TCTACCTTGAGTCTAACAACATTTTCATTTCCGAAAGGCCAACAGATGTTCTCCAGACAG
TCAAGTTATTAGATCTTTCCTCTAATCAATTAATTGATGAAAATCAGCTGTATCTGATAG
CCCACCTGCCCAGGTTAGAACAATTAATCCTCTCTGACACTGGAATTTCTTCTCTACATT
TTCCGGATGCTGGAATTGGGTGCAAAACGTCCATGTTCCCATCCTTGAAGTACCTGGTAG
TAAACGACAATCAGATATCACAATGGTCGTTTTTCAATGAGCTAGAGAAGTTACCAAGTC
TACGGGCTTTGTCCTGCCTAAGAAACCCCCTGACCAAAGAGGACAAAGAAGCAGAGACGG
CGCGACTACTCATTATCGCCAGCATTGGCCAGCTGAAGACGCTGAACAAATGTGAGATTC
TCCCCGAGGAGAGGCGGAGAGCTGAGCTTGACTACCGAAAAGCTTTTGGAAATGAGTGGA
AACAGGCTGGTGGACATAAGGATCCGGAAAAAAACAGACTCAGCGAAGAATTCCTCACAG
CCCATCCCAGATACCAGTTCCTCTGCCTGAAATATGGTGCACCTGAAGATTGGGAACTCA
AAACACAGCAACCACTTATGCTGAAAAACCAGCTACTAACACTGAAGATAAAATACCCTC
ATCAACTTGATCAGAAAGTCCTGGAGAAACAACTGCCGGGCTCCATGACAATTCAAAAGG
TGAAGGGATTGCTGTCACGTCTTCTCAAAGTTCCTGTGTCAGACCTTCTGTTGTCCTATG
AAAGTCCCAAAAAGCCGGGCAGAGAAATCGAGCTGGAAAATGACCTAAAGTCATTACAGT
TTTATTCTGTGGAAAATGGAGATTGTCTATTAGTGCGATGGTGACAACCAACTAATAAAA
TTTAAAGACCACACTGCTTATCGTGTCTGGGGTTCACCGGAAATAAATGATTCACTGGAA
CAATTCTACTGTCAAAACAAAGGGGGTTTACAACTTGTCCTAAGTATAACAAGGGATGTA
TTTTTAGTTGGGAAGTGACCATTTCTAGGCTTATACATAATAGCAATAATAAAGGCTTTG
AACCTACAGaaaaaaaaaaaaa