>AY046560 Homo sapiens methylenetetrahydrofolate reductase short isoform mRNA, partial cds; alternatively spliced (1135 bp)
CTCCAAATAACCACCCTCCTCTTCAGGACACCTCAAAGATGTCCAACGCCAGCTGAAAAG
GGGGGTAAAAATGCAGGTTCCATTTGACAGTGTGACGTATCTGAAATCAGAAAGGACTTG
TCAACTCTGGGAACACAACTCAAGTTTTCCCAGGATGCTTTGCAGGGGGAAGCTGGACTG
TCAGTGACCCAGAAAGGGTGAGGGATAGAGTGAGAAAGGACTGGAGAAGCTAAAACAGCA
GCATGATAAGCACAAAGTCCTGTGAGGAAGCTCATTCTGAAAACGCTTGTTTCATTCCAA
ACTCTTTTCAGATGGAAATAAAAGGAAACATGGGTGGGATTTACTGGAGCTGGCCTGGAT
TCTCCCTCAGATTCCAGGAGGGGTTATGAGAAAAGACCCCAGACTTAGGCACGTGAAGCA
GGGTAGACGCTTCGAGAGCCCTGGCTGCGGtccccaggccccacccgctgccacctgcgg
gcccagattggcccggccccacccccggcAACGCCTCTCTCAGTCCCTTAGCAACCGCCC
CCTCCCCAGGCCGACTCCGCCGGCTTCTTACCAGCTCCTCGGGGGTGCGGGTCTCACGCT
CACCgcagcagcagcaccacctgcagcagcagcacagAGACCCCCTGCACCCCGCCATCT
TCCTCCTTTACTGCCACTCTGGACCCCTCTACCAACCCCCTCCCAGCCAGGATCTGCGCC
TCACGTGACTGGCCCCGGGACGGTCACGTGGCCCTCTCGAGCTCTGGGACTGAGACCAGG
AGTGGCTGCAGACGGGTGGGGCGAGGACTCGCGTCACATGACGATAAAGGCACGGCCTCC
AACGAGACCTGTGGGCACGGCCATGTTGGGGGCGGGGCTTCCGGTCACCCGCGCCGGTGG
TTTCCGCCCTGTAGGCCCGCCTCTCCAGCAACCTGACACCTGCGCCGCGCCCCTTCACTG
CGTTCCCCGCCCCTGCAGCGGCCACAGTGGTGCGGCCGGCGGCCGAGCGTTCTGAGTCAC
CCGGGACTGGAGGTAGGAACCCAGCCATGGTGAACGAAGCCAGAGGAAACAGCAGCCTCA
ACCCCTGCTTGGAGGGCAGTGCCAGCAGTGGCAGTGAGAGCTCCAAAGATAGTTC